Dr Widodo Judarwanto pediatrician

Audi, berumur 2 tahun tiba-tiba tidak mau minum susu dari botol dan tidak mau makan. Bahkan anak saya sampai nangis menjerit-jerit kalau mau ditidurkan dan diberi susu botol. Ternyata di mulutnya timbul banyak sariawan. Beberapa hari kemudian, di kedua telapak kaki dan tangannya muncul bintil-bintil berisi air. Bisul itu semula kecil tetapi lama kelamaan bertambah besar. Bentuknya mirip seperti cacar air. Karena selama 3 hari tidak mau makan dan minum sama sekali akhirnya dirawat di rumah sakit dan didiagnosis terkena “flu Singapura

HFMD (Hand Foot Mouth Disease) atau KTM (Kaki tangan dan Mulut) atau dahulu sering disebut “Flu Singapura” sebenarnya adalah penyakit yang didunia kedokteran dikenal sebagai Hand, Foot, and Mouth Disease (HFMD) atau penyakit Kaki, Tangan dan Mulut ( KTM )

Sebenarnya istilah Flu Singapura adalah kurang tepat karena dalam literatur dan dalam istyilah dunia kedokteran tidak dikenal istilah demikian. Mengapa disebut flu singapura sampai sekarang juga belum diketahui asal usulnya. Mungkin saja karena pertengahan September tahun 2000 lalu, penyakit tangan, kaki dan mulut pernah merebak di Singapura. Pemerintah Singapura bahkan sampai menganjurkan agar seluruh restoran siap saji, kolam renang, dan tempat bermain anak-anak ditutup sementara setelah tiga anak diberitakan meninggal karena diduga terkena penyakit tersebut. Sebanyak 440 taman kanak-kanak (TK) dan 557 pusat perawatan anak diliburkan.

Penyakit KTM ini adalah penyakit infeksi yang disebabkan oleh virus RNA yang masuk dalam famili Picornaviridae (Pico, Spanyol = kecil ), Genus Enterovirus ( non Polio ). Genus yang lain adalah Rhinovirus, Cardiovirus, Apthovirus. Didalam Genus enterovirus terdiri dari Coxsackie A virus, Coxsackie B virus, Echovirus dan Enterovirus.


  • Penyebab yang paling sering terjadi adalah Coxsackie A16,
  • sedangkan yang sering memerlukan perawatan karena keadaannya lebih berat atau ada komplikasi sampai meninggal adalah Enterovirus 71.
  • Berbagai enterovirus dapat menyebabkan berbagai penyakit.


  • Penyakit ini sangat menular dan sering terjadi dalam musim panas.
  • Merupakan penyakit umum atau biasaterjadi pada kelompok masyarakat yang padat dan menyerang anak-anak usia 2 minggu sampai 5 tahun ( kadang sampai 10 tahun ).
  • Orang dewasa umumnya kebal terhadap enterovirus.
  • Penularannya melalui kontak langsung dari orang ke orang yaitu melalui droplet, pilek, air liur (oro-oro), tinja, cairan dari vesikel atau ekskreta. Penularan kontak tidak langsung melalui barang, handuk, baju, peralatan makanan, dan mainan yang terkontaminasi oleh sekresi itu.
  • Tidak ada vektor tetapi ada pembawa seperti nyamuk atau lalat .
  • Penyakit ini mempunyai imunitas spesifik, namun anak dapat terkena KTM lagi oleh virus strain Enterovirus lainnya. Masa Inkubasi 2 ? 5 hari.
Baca  Terapi Obat HFMD (Hand Foot Mouth Disease) atau KTM (Kaki tangan dan Mulut)


  • Mula-mula demam tidak tinggi 2-3 hari,
  • iikuti sakit leher (pharingitis), tidak ada nafsu makan, pilek, gejala seperti ?flu? pada umumnya yang tak mematikan.
  • Timbul vesikel yang kemudian pecah, ada 3-10 ulcus dumulut seperti sariawan ( lidah, gusi, pipi sebelah dalam ) terasa nyeri sehingga sukar untuk menelan.Bersamaan dengan itu timbul rash/ruam atau vesikel (lepuh kemerahan/blister yang kecil dan rata), papulovesikel yang tidak gatal ditelapak tangan dan kaki.Kadang-kadang rash/ruam (makulopapel) ada dibokong.
  • Penyakit ini membaik sendiri dalam 7-10 hari.Bila ada muntah, diare atau dehidrasi dan lemah atau komplikasi lain maka penderita tersebut harus dirawat.

Waspadai gejala dan tanda yang berbahaya, di anataranya adalah :

  • Hiperpireksia ( suhu lebih dari 39 der. C).
  • Demam tidak turun-turun (Prolonged Fever)
  • Tachicardia (denyut jantung cepat)
  • Tachypneu (sesak)
  • Tidak mau makan, muntah atau diare sehingga kekurangan cairan dehidrasi.
  • Lethargi atau lemah dan kesadaran menurun
  • Nyeri pada leher,lengan dan kaki.
  • kejang.


Dalam keadaan daya tahan tubuh yang sangat rendah atau immunocomprimized dapat terjadi komplikasi yang berbahaya dan mengancam jiwa. Namun hal ini sangat jarang terjadi, diantaranya komplikasi yang dapat terjadi adalah sebagai berikut :

  • Meningitis atau infeksi otak (aseptic meningitis, meningitis serosa/non bakterial)o Encephalitis ( bulbar )o
  • Myocarditis atau gangguan jantungh (Coxsackie Virus Carditis) atau pericarditiso Paralisis akut flaksid

Beberapa penyakit yang juga disebabkan karena virus sejenis ini adalah penyakit ini :

  1. Vesicular stomatitis dengan exanthem (KTM) – Cox A 16, EV 71 (Penyakit ini)
  2. Vesicular Pharyngitis (Herpangina) – EV 703. Acute Lymphonodular Pharyngitis – Cox A 10


  • Bahan pemeriksaan yang dapat diambil dari tubuh dapat diambil dari tinja, usap rektal, cairan serebrospinal dan usap/swab ulcus di mulut/tenggorokan, vesikel di kulit spesimen atau biopsi otak.
  • Spesimen dibawa dengan Hanks Virus Transport. Isolasi virus dencara biakan sel dengan suckling mouse inoculation.Setelah dilakukan “Tissue Culture”, kemudian dapat diidentifikasi strainnya dengan antisera tertentu / IPA, CT, PCR dll.
  • Dapat dilakukan pemeriksaan antibodi untuk melihat peningkatan titer.
Baca  Cacar Monyet atau Monkeypox Virus (MPXV), Manifestasi Klinis dan Pencegahannya

Diagnosa Laboratorium

  1. Deteksi Virus Immuno histochemistry (in situ)o Imunofluoresensi antibodi (indirek)o Isolasi dan identifikasi virus.Pada sel Vero ; RD ; L
  2. BUji netralisasi terhadap intersekting poolsAntisera (SCHMIDT pools) atau EV-71 (Nagoya) antiserum.2. Deteksi RNA :RT-PCRPrimer : 5 CTACTTTGGGTGTCCGTGTT 35 GGGAACTTCGATTACCATCC
  3. Partial DNA sekuensing (PCR Product)3. Serodiagnosis :Serokonversi paired sera dengan uji serum netralisasi terhadap virus EV-71 (BrCr, Nagoya) pada sel Vero.
  4. Uji ELISA sedang dikembangkan.Sebenarnya secara klinis sudah cukup untuk mendiagnosis KTM, hanya kita dapat mengatahui apakah penyebabnya Coxsackie A-16 atau Enterovirus 71.

Penaganan :

  • Istirahat yang cukupo
  • Pengobatan spesifik tidak ada
  • Pengobatan simptomatik atau mengobati gejalanya , tidak perlu pemberian antibiotika
  • Antiseptik didaerah mulut
  • Pemberian obat demam atau penghilang rasa sakitAnalgesik misal parasetamol
  • Cairan cukup untuk dehidrasi yang disebabkan sulit minum dan karena demam
  • Pengobatan suportif lainnya
  • Penyakit ini adalah dapat sembuh sendiri atau self limiting diseases.
  • Biasanya akan membaik dalam 7-10 hari, pasien perlu istirahat karena daya tahan tubuh menurun.
  • Pasien yang dirawat adalah yang dengan gejala berat dan komplikasi tersebut diatas.
  • Pada penderita dengan kekebalan tubuh yang rendah atau neonatus dapat diberikan : Immunoglobulin IV (IGIV), pada pasien imunokompromis atau neonatus

Pencegahan :

  • Penyakit ini diduga sering terjadi pada masyarakat dengan sanitasi yang kurang baik. Tetapi tampaknya pada masyarakat menenggah ke atas dengan sanitasi yang baikpun masih sering tyerjadi.
  • Sering terjadi penularan d tempat yang padat seperti sekolah.
  • Kebersihan Higiene dan Sanitasi dengan memperhatikan kesehatan lingkungan dan perorangan misal cuci tangan, desinfeksi peralatan makanan, mainan, handuk yang memungkinkan terkontaminasi.
  • Bila perlu anak tidak bersekolah selama satu minggu setelah timbul rash sampai panas hilang.
  • Pasien sebenarnya tak perlu diasingkan karena ekskresi virus tetap berlangsung beberapa minggu setelah gejala hilang, yang penting menjaga kebersihan perorangan.
  • Di Rumah sakit “Universal Precaution” harus dilaksanakan.
  • Penyakit ini belum dapat dicegah dengan vaksin (Imunisasi)





Information on this web site is provided for informational purposes only and is not a substitute for professional medical advice. You should not use the information on this web site for diagnosing or treating a medical or health condition. You should carefully read all product packaging. If you have or suspect you have a medical problem, promptly contact your professional healthcare provider

Copyright © 2020, www.obatonline.com INFO ONBAT INDONESIA,  Information Education Network. All rights reserved



    1. Seperti flu yang lain setelah sembuh dalam beberapa periode kemudian anak masih bisa terkena kembali, berbeda dengan infeksi cacar air dimana anak hanya dapat terkena infeksi sekali dalam seumur hidupnya

  1. Anak saya pernah mengalami HFMD dan dokter memberikan antiboitik, dg dasar pengetahuan yang sy dapat di internet antibiotik tsb tdk saya berikan. Setelah 5 hari anak sy mulai membaik dan bermain dg teman2 spt biasa ttp malam harinya panas kambuh dan timbul beberapa ruam di sekitar leher. Keesokan harinya sy bergegas membawa anak sy ke dokter dan dinyatakan menderita infeksi sekunder akibat tdk diberikan antibiotik. Mohon penyelasan atas kasus anak sy. Terimakasih.

Leave a Reply

Your email address will not be published. Required fields are marked *