INFO OBAT INDONESIA

Terapi Obat HFMD (Hand Foot Mouth Disease) atau KTM (Kaki tangan dan Mulut)

Audi, berumur 2 tahun tiba-tiba tidak mau minum susu dari botol dan tidak mau makan. Bahkan anak saya sampai nangis menjerit-jerit kalau mau ditidurkan dan diberi susu botol. Ternyata di mulutnya timbul banyak sariawan. Beberapa hari kemudian, di kedua telapak kaki dan tangannya muncul bintil-bintil berisi air. Bisul itu semula kecil tetapi lama kelamaan bertambah besar. Bentuknya mirip seperti cacar air. Karena selama 3 hari tidak mau makan dan minum sama sekali akhirnya dirawat di rumah sakit dan didiagnosis terkena “flu Singapura.
HFMD (Hand Foot Mouth Disease) atau KTM (Kaki tangan dan Mulut) atau dahulu serimg disebut “Flu Singapura” sebenarnya adalah penyakit yang didunia kedokteran dikenal sebagai Hand, Foot, and Mouth Disease (HFMD) atau penyakit Kaki, Tangan dan Mulut ( KTM ). Mengapa disebut flu singapura karena pertengahan September tahun 2000 lalu, penyakit tangan, kaki dan mulut pernah merebak di Singapura. Pemerintah Singapura bahkan sampai menganjurkan agar seluruh restoran siap saji, kolam renang, dan tempat bermain anak-anak ditutup sementara setelah tiga anak diberitakan meninggal karena diduga terkena penyakit tersebut. Sebanyak 440 taman kanak-kanak (TK) dan 557 pusat perawatan anak diliburkan. Penyakit KTM ini adalah penyakit infeksi yang disebabkan oleh virus RNA yang masuk dalam famili Picornaviridae (Pico, Spanyol = kecil ), Genus Enterovirus ( non Polio ). Genus yang lain adalah Rhinovirus, Cardiovirus, Apthovirus. Didalam Genus enterovirus terdiri dari Coxsackie A virus, Coxsackie B virus, Echovirus dan Enterovirus. Penyebab yang paling sering terjadi adalah Coxsackie A16, sedangkan yang sering memerlukan perawatan karena keadaannya lebih berat atau ada komplikasi sampai meninggal adalah Enterovirus 71. Berbagai enterovirus dapat menyebabkan berbagai penyakit. Penyakit ini sangat menular dan sering terjadi dalam musim panas. Merupakan penyakit umum atau biasaterjadi pada kelompok masyarakat yang ?crowded? dan menyerang anak-anak usia 2 minggu sampai 5 tahun ( kadang sampai 10 tahun ). Orang dewasa umumnya kebal terhadap enterovirus. Penularannya melalui kontak langsung dari orang ke orang yaitu melalui droplet, pilek, air liur (oro-oro), tinja, cairan dari vesikel atau ekskreta. Penularan kontak tidak langsung melalui barang, handuk, baju, peralatan makanan, dan mainan yang terkontaminasi oleh sekresi itu. Tidak ada vektor tetapi ada pembawa seperti nyamuk atau lalat . Penyakit ini mempunyai imunitas spesifik, namun anak dapat terkena KTM lagi oleh virus strain Enterovirus lainnya. Masa Inkubasi 2 ? 5 hari.
TANDA DAN GEJALA HFMD (Hand Foot Mouth Disease) atau KTM (Kaki tangan dan Mulut)
  • Mula-mula demam tidak tinggi 2-3 hari,
  • diikuti sakit leher (pharingitis), tidak ada nafsu makan, pilek, gejala seperti ?flu? pada umumnya yang tak mematikan.
  • Timbul vesikel yang kemudian pecah, ada 3-10 ulcus dumulut seperti sariawan ( lidah, gusi, pipi sebelah dalam ) terasa nyeri sehingga sukar untuk menelan.Bersamaan dengan itu timbul rash/ruam atau vesikel (lepuh kemerahan/blister yang kecil dan rata), papulovesikel yang tidak gatal ditelapak tangan dan kaki.Kadang-kadang rash/ruam (makulopapel) ada dibokong.
  • Penyakit ini membaik sendiri dalam 7-10 hari.Bila ada muntah, diare atau dehidrasi dan lemah atau komplikasi lain maka penderita tersebut harus dirawat.

Waspadai gejala dan tanda yang berbahaya, di anataranya adalah :

  • Hiperpireksia ( suhu lebih dari 39 der. C).
  • Demam tidak turun-turun (Prolonged Fever)
  • Tachicardia (denyut jantung cepat)
  • Tachypneu (sesak)
  • Tidak mau makan, muntah atau diare sehingga kekurangan cairan dehidrasi.
  • Lethargi atau lemah dan kesadaran menurun
  • Nyeri pada leher,lengan dan kaki.
  • kejang.
Baca  Tanda Dan Gejala Demam Berdarah Dengue, Demam Dengue dan DSS

Komplikasi

Dalam keadaan daya tahan tubuh yang sangat rendah atau immunocomprimized dapat terjadi komplikasi yang berbahaya dan mengancam jiwa. Namun hal ini sangat jarang terjadi, diantaranya komplikasi yang dapat terjadi adalah sebagai berikut :

  • Meningitis atau infeksi otak (aseptic meningitis, meningitis serosa/non bakterial)o Encephalitis ( bulbar )o
  • Myocarditis atau gangguan jantungh (Coxsackie Virus Carditis) atau pericarditiso Paralisis akut flaksid

beberapa penyakit yang juga disebabkan karena virus sejenis ini adalah penyakit ini :

  • Vesicular stomatitis dengan exanthem (KTM) – Cox A 16, EV 71 (Penyakit ini)
  • Vesicular Pharyngitis (Herpangina) – EV 703. Acute Lymphonodular Pharyngitis – Cox A 10

LABORATORIUM :

  • Bahan pemeriksaan yang dapat diambil dari tubuh dapat diambil dari tinja, usap rektal, cairan serebrospinal dan usap/swab ulcus di mulut/tenggorokan, vesikel di kulit spesimen atau biopsi otak.
  • Spesimen dibawa dengan Hanks Virus Transport. Isolasi virus dencara biakan sel dengan suckling mouse inoculation.Setelah dilakukan “Tissue Culture”, kemudian dapat diidentifikasi strainnya dengan antisera tertentu / IPA, CT, PCR dll.
  • Dapat dilakukan pemeriksaan antibodi untuk melihat peningkatan titer.
Diagnosa Laboratorium adalah sebagai berikut :
  1. Deteksi Virus Immuno histochemistry (in situ)o Imunofluoresensi antibodi (indirek)o Isolasi dan identifikasi virus.Pada sel Vero ; RD ; L
  2. BUji netralisasi terhadap intersekting poolsAntisera (SCHMIDT pools) atau EV-71 (Nagoya) antiserum.2. Deteksi RNA :RT-PCRPrimer : 5 CTACTTTGGGTGTCCGTGTT 35 GGGAACTTCGATTACCATCC
  3. Partial DNA sekuensing (PCR Product)3. Serodiagnosis :Serokonversi paired sera dengan uji serum netralisasi terhadap virus EV-71 (BrCr, Nagoya) pada sel Vero.
  4. Uji ELISA sedang dikembangkan.Sebenarnya secara klinis sudah cukup untuk mendiagnosis KTM, hanya kita dapat mengatahui apakah penyebabnya Coxsackie A-16 atau Enterovirus 71.

Terapi Obat

  • Pengobatan penyakit tangan-kaki-dan-mulut (HFMD) sangat mendukung. Faktanya, tidak ada agen antivirus yang spesifik untuk agen etiologi tersebut. Pastikan asupan cairan yang cukup untuk mencegah dehidrasi. Cairan dingin biasanya lebih disukai. Zat pedas atau asam dapat menyebabkan ketidaknyamanan. Hidrasi intravena mungkin diperlukan jika pasien mengalami dehidrasi sedang hingga berat atau jika ketidaknyamanan menghalangi asupan oral. Demam dapat diobati dengan antipiretik. Nyeri dapat diobati dengan acetaminophen atau ibuprofen dosis standar. Analgesia langsung juga dapat diterapkan pada rongga mulut melalui obat kumur atau semprotan. Imunoglobulin intravena (IVIG) dan milrinone telah menunjukkan beberapa kemanjuran dalam beberapa laporan
  • Terdapat kelangkaan relatif pilihan pengobatan untuk kasus HFMD terkait enterovirus. Penelitian terbaru telah menghasilkan beberapa terapi baru dan baru yang menjanjikan yang menargetkan mekanisme aksi virus tertentu. Ini termasuk umpan molekuler, antagonis reseptor, penghambat pelapis dan translasi, penghambat pemrosesan poliprotein, dan penghambat replikasi. Pleconaril adalah inhibitor tanpa lapisan yang menjanjikan untuk infeksi terkait enterovirus 71.
  • Amantadine dan quinacrine, keduanya penghambat terjemahan, dan ribavirin, penghambat replikasi, juga sedang diselidiki sebagai pilihan pengobatan.
  • Antipiretik / analgesik Agen ini digunakan untuk mengontrol demam dan nyeri.
    • Asetaminofen (Tylenol, Anacin Bebas Aspirin, Demam) Mengurangi demam dengan bekerja langsung di pusat pengatur panas hipotalamus, yang meningkatkan pembuangan panas tubuh melalui vasodilatasi dan keringat.
    • Ibuprofen (Motrin, Ibuprin) Salah satu dari sedikit NSAID yang diindikasikan untuk menurunkan demam.
  • Anestesi topikal Obat ini dapat diterapkan pada ulserasi untuk mengontrol nyeri.
  • Anestesi Lidokain (Dermaflex) Menurunkan permeabilitas ion natrium di membran saraf. Ini menghasilkan penghambatan depolarisasi, menghalangi transmisi impuls saraf.
  • Antihistamin Obat ini bekerja dengan penghambatan kompetitif histamin pada reseptor H1.
    • Diphenhydramine hydrochloride (Benadryl, Benylin) Untuk menghilangkan gejala gejala yang disebabkan oleh pelepasan histamin dalam reaksi alergi.

Leave a Reply

Your email address will not be published. Required fields are marked *

× Konsultasi Whatsapp Obat, Chat Di Sini